How to create Map Container Packages for use with GPS Map Version 1 5 mmm WPT WP 1 19 DTG 0 60 km 85 TTG 0 234 m E 1 0 06 ALT 630 m 14 27 32 SPD 222 kmh RET i o eT m QA TH pE S A b OC Ng t MARKI KB zs N Kreuzacker Ne m WHISKEY e AT M qH A340 85 a DM NM Mame Dates Extras Find eels Map Preparation Package User s Manual Page 1 Copyright 1995 97 Gerd Staudenmaier Friedrichshafener
USER GUIDE applied biosystems by Life technologies PrepSEQ Residual DNA Sample Preparation Kit for use with resDNASEQ Quantitative E coli DNA kit resDNASEQ Quantitative Vero DNA kit Publication Part Number 4460663 Rev B Revision Date May 2011 6 technologies For research use only Not intended for any human or animal therapeutic or diagnostic use Information in this document is subject to change without notice APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANT
1 Introduction This manual gives an introduction into basic one and two dimensional nuclear magnetic resonance NMR spectroscopy After a short introduction the acquisition of basic 1D H and C NMR spectra is described in the Chapters 3 to 7 Homonuclear 2D H H correlation spectra are described in Chapter 8 COSY 9 TOCSY 10 ROESY and 11 NOESY Heteronuclear 2D C H correlation experiments are described in Chapter 12 XHCORR 13 COLOC 14 HMQC and 15 HMBC
Pacific Rim National Park Reserve parkscanada gc ca PACIFIC RIM NATIONAL PARK RESERVE WEST COAST TRAIL 2014 HIKER PREPARATION GUIDE As one of 44 national parks and national park reserves across the country Pacific Rim National Park Reserve protects for all time a significant example of Canada s natural and cultural heritage to encourage public understanding appreciation and enjoyment for present and future generations Vancouver Island and facing the open along the
PACIFIC BIOSCIENCES Template Preparation and Sequencing Guide For Research Use Only Not for use in diagnostic procedures P N 000 710 821 07 06122013 Copyright 2010 2013 Pacific Biosciences of California Inc All rights reserved Information in this document is subject to change without notice Pacific Biosciences assumes no responsibility for any errors or omissions in this document PACIFIC BIOSCIENCES DISCLAIMS ALL WARRANTIES WITH RESPECT TO
SON Y 0 9 3 2 4 4 Wireless Laser Mouse 5 1 7 VGP WMS10 Operating Instructions Mode d emploi Manual de instrucciones Manual de Instru es IMPORTANTE POR FAVOR LEA DETALLADAMENTE ESTE MANUAL DE INSTRUCCIONES ANTES DE CONECTAR Y OPERAR ESTE EQUIPO RECUERDE QUE UN MAL USO DE SU APARATO PODR A ANULAR LA GARANTIA 4 427 509 31 1 O 2012 Sony Corporation Printed in China VIN O To reduce the risk of fire or elect
FUNAI DV220FX5 DVD Player VCR with Line in Recording Owner s Manual Zv pasy S VHS J FUNAI 2014 Funai Electric Co Ltd PRECAUTIONS Safety Instructions The model and serial numbers of this unit may be found on the cabinet Model No You should record and retain those numbers for future reference n Serial No WARNING TO REDUCE THE RISK OF FIRE OR ELECTRIC SHOCK DO NOT EXPOSE THIS APPARATUS TO RAIN OR MOISTURE APPARATUS SHALL
EpiNext High Sensitive DNA Library Preparation Kit Illumina Base Catalog P 1053 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses The EpiNext High Sensitive DNA Library Preparation Kit Illumina is suitable for preparing a DNA library using sub nanogram amounts of DNA input for next generation sequencing applications using an Illumina sequencer These applications include genomic DNA seq ChIP seq MeDIP hMeDIP seg classical bisulfite seg and targeted re sequenci
SPECTRA J DEEP STORAGE EXPERTS Tape Series Mid Range Libraries T200 T380 AnD T680 Site Preparation Guide SPECTRALOGIC COM Copyright Notices Trademarks Copyright 2008 2015 Spectra Logic Corporation All rights reserved This item and the information contained herein are the property of Spectra Logic Corporation Except as expressly stated herein Spectra Logic Corporation makes its products and associated documentation on an AS IS
card Automated multi step protein purification KTA 3D Kit System preparation Column preparation Purification protocols System maintenance Results and Evaluation Amersham cue 18 1161 47 AB 2002 12 pl Biosciences card Automated multi step protein purification System preparations KTA 3D Kit This cue card describes general system preparations To ensure the best results use high purity water and chemicals It is also recom
GZ lys The Science of Lysing USER MANUAL MANUEL UTILISATEUR PRECELLYS Evolution SUPER Homogenizer SAMPLE PREPARATION amp CELL LYSIS TECHNOLOGIES PRECELLYS Evolution USER MANUAL Produced by BERTIN TECHNOLOGIES Parc d activit s du Pas du Lac 10 bis avenue Amp re BP 284 78053 Saint Quentin en Yvelines Cedex France Phone 33 0 1 39 30 61 60 Email info precellys com Reference 002520 800 DU003 B bertin Page 2 TECHNOLOGIES
University of Toronto ECE532 Digital Hardware Module m02 Adding IP and Device Drivers GPIO and Polling Version for EDK 10 1 03 as of January 7 2009 Acknowledgement This lab is derived from a Xilinx lab given at the University of Toronto EDK workshop in November 2003 Many thanks to Xilinx for allowing us to use and modify their material Goals Use Xilinx tools to add to the basic MicroBlaze system that was built in Module m01 A primary goal of this lab is to und
This section gives outline of device fabrication and subsequent mobility measurements Thursday September 25 2014 3 31 PM Fabrication of mobility measurement devices This is a simple 3 step process which can be carried out using contact aligner for lithography Hall devices are either four contact van der Pauw or six contact Hall bar devices Supplementary information on Hall bar devices and measurements is provided in Appendix from Lake Shore 7500 9500 Series Hall System Us
Continental COTTE ET TM w V IT Refrigerated Bases amp Pizza Prep Tables Refrigerators amp Freezers Please fill in the following information for your NEW unit carefully read the instructions in this manual and file it for future reference MODEL NO SERIAL NO PURCHASED FROM INSTALL DATE 1 800 523 7138
illumina TruSight Rapid Capture sample Preparation Guide D AA AN tose es RASA eg EE EE EE EE AGAAT GATAACAG TAACACACTTCTGT TV I ACTTGI TGATCCACTGATTCAACG TACCGTATCAAT TGAGAC TAAATAT TAACGTACCAT TAAGAGC TACCGTCT TC TGT TAACC T TAAGAT TACTT GATCCAC TGATICAACGTACCGTAAAAA SCRA CATT CAACOTACCAAGATIACTIGATCC ACT GA TCAACOTACCON AACGAACGTAT CAT GAGACTARATATAACGTAGCALPAAGAGCIACCGTCTTCIGTIAACCTIANGATIACTTGATGCAC I GATTCAADO TAGS TAACGAACATE SJGACGAAAAGAATGATAACAG TAACACACTTCTGT TAACC T
Kawasaki KX250 Motorcycle Assembly amp Preparation Manual Foreword In order to ship Kawasaki vehicles as effi ciently as possible they are partially disassem bled before crating Since some of the most commonly removed parts have a direct bear ing on a vehicle s reliability and safety consci entious sale assembly and preparation be comes extremely important Good setup pro cedures can prevent needless warranty claims and give customers a greater sens
CTX Mate Version 0 48 Data Preparation Guide Jack Devanney Sisyphus Beach Tavernier Florida 2006 Copyright c 2006 Jack Devanney Permission is granted to copy distribute and or modify this document under the terms of the Gnu Free Documentation License GFDL Version 1 2 or any later version published by the Free Software Foundation with no Invarient Sections no Front Cover Texts and no Back Cover Texts A copy of the GFDL is available at CTX Mate is distributed
E SEC 2EC 2GC P 4GC 1 0512 Operator s Instruction Manual FLOOR GRINDING amp SURFACE PREPARATION Gasoline Electric e Propane 2EC 2GC 2GC P 4EC 4GC 4GC P Manual Portable 100 Thomas Johnson Drive Frederick MD 21702 4600 USA Phone 301 663 1600 1 800 638 3326 SV SCCMAIS Fax 301 663 1607 1 800 447 3326 PADIERNA USA Website www contrxsystems com tw 2012 Email sales contrxsystems com A Division of Equipment Development Compan
gt applied AB Biosystems Applied Biosystems SOLID 4 System Library Preparation Guide April 2010 Library Templated Bead Instrument Preparation Preparation Operation For Research Use Only Not intended for any animal or human therapeutic or diagnostic use This user guide is the proprietary material of Applied Biosystems LLC or its affiliates and is protected by laws of copyright The customer of the SOLID System is hereby granted limited non exclusive rig