illumina Whole Genome Sequencing services User Guide ESA VT TR O Ula ea OL L eG AOU IAL gw TCA A EO VY NE POTU A MMs GEC Ap Olly call SS GTACCATTAAGAGCTAC TGATAACAGTAACACACTTCTGTTAACCTTAAGAT TACTTGT TGATCCACTGATTCAACGTACCGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCTIAAGATTACTTGATCCACTGATTCAACGTACCG IGAGT GAT TCAACGTACCAAGAT TACT IGATCCACT GAT IGAAOGTAGGGT R ae a CR AO CLA TA ATON TOANDE eee eee GAAAAGAATGATAACAGTAACACACTTCTGTTAACCTT UVAS O TYM TACCG TO OO NTE
Gen eCop ajg Expressway to Discovery Genome CRISP CRISPR Cas9 Products and Services User Manual GeneCopoeia Inc 9620 Medical Center Drive 101 Rockville MD 20850 USA 301 762 0888 866 360 9531 inquiry genecopoeia com www genecopoeia com 2014 GeneCopoeia Inc Genome CRISP CRISPR Cas9 Products and Services USER MANUAL Genome CRISP CRISPR Cas9 Products and Services Introduction ll Products and Services lll Related Service
Gen Cor 5 pia Expressway to Discovery Genome CRISPR CRISPR human SQRNA libraries User Manual GeneCopoeia Inc 9620 Medical Center Drive 101 Rockville MD 20850 USA 301 762 0888 866 360 9531 inquiry genecopoeia com www genecopoeia com 2015 GeneCopoeia Inc USER MANUAL Genome CRISP CRISPR human sgRNA libraries Table of Contents l IF OQUCH ORAS raia ea bd o DS A 3 Es SSO PING ANd STO RAGS aa inss sina sds eia a O SOL ESA DD Sa DS
GenomeStudio Genotyping Module v1 0 User Guide An Integrated Platform for Data Visualization and Analysis FOR RESEARCH ONLY ooo e 000 ILLUMINA PROPRIETARY u m n a Part 11318815 o QO OQO Notice This publication and its contents are proprietary to Illumina Inc and are intended solely for the contractual use of its customers and for no other purpose than to operate the system described herein This publication and its contents shall not be used or d
Isaac Whole Genome Sequencing v2 Introduction Running Isaac Whole Genome Sequencing Isaac Whole Genome Sequencing Output Isaac Whole Genome Sequencing Methods 2 Technical Assistance O QD DM Ca LZS ae Ss Sa oces tO a ILLUMINA PROPRIETARY illumina 15050954 Rev B August 2014 This document and its contents are proprietary to Illumina Inc and its affiliates Illumina and are intended solely for the contractual use of its customer in connection with the
An introduction to the PopGenome package Bastian Pfeifer May 2 2015 Contents 1 2 Introduction Installing PopGenome Reading data alignments 3 1 The slots of the class region data Reading data with GFF GTF information 4 1 Splitting the data into subsites Define the populations Define an outgroup Statistics 7 1 Neutrality statistics 2 7 2 The slot region stats Sliding Window Analyses 8 1 Scanning the whole data 8
Genome TALER TALEN and TALE TF Products and Services Genome TALER TALEN and TALE TF Products and Services User Manual GeneCopoeia Inc 9620 Medical Center Drive 101 Rockville MD 20850 USA 301 762 0888 866 360 9531 inquiry genecopoeia com www genecopoeia com 2014 GeneCopoeia Inc Genome TALER TALEN and TALE TF Products and Services USER MANUAL Genome TALER TALEN and TALE TF Products and Services Introduction to TAL effectors
Savant Genome Browser User Manual May 7 2010 Author Marc Fiume Contact savant cs toronto edu Website http compbio cs toronto edu savant This document applies to Savant version 1 02 Contents 1 Introduction 4 Ted What is Savant csc ea ve ee ee D te ee ee ee REARS AA ee 4 1 2 r Who shoulduse Savant i g insu ei e RS Bae Me are te a Qe ae ee we 4 2 Formatting and Loading Data 5 2 1 Supported File Formats 5 2 1
GCTA a tool for Genome wide Complex Trait Analysis Version 1 11 13 Sep 2012 Overview GCTA Genome wide Complex Trait Analysis is designed to estimate the proportion of phenotypic variance explained by genome or chromosome wide SNPs for complex traits GCTA was developed by Jian Yang Hong Lee Mike Goddard and Peter Visscher and is maintained in Peter Visscher s lab at the University of Queensland GCTA currently supports the following functionalities Es
Gen eCop 5 niai Expressway to Discovery Genome TALER amp Genome CRISPR Mouse ROSA26 Safe Harbor Gene Knock in Kit Catalog SH ROS K100 Catalog SH ROS K000 Catalog SH ROS K200 Catalog SH ROS K002 User Manual GeneCopoeia Inc 9620 Medical Center Drive 101 Rockville MD 20850 USA 301 762 0888 866 360 9531 inquiry genecopoeia com www genecopoeia com 2015 GeneCopoeia Inc USER MANUAL Genome TALER Mouse ROSAZ26 Safe Harbor Gene K
BD GenomeWalker Universal Kit User Manual Cat No 638904 PT3042 1 PR47605 Published 23 August 2004 BD GenomeWalker Universal Kit User Manual Table of Contents I Introduction 3 ll List of Components 7 Ill Additional Materials Required 8 IV Construction of BD GenomeWalker Libraries 10 A General Considerations 10 B Quality of Genomic DNA 10 C Digestion of Genomic DNA 11 D Purification of DNA 11 E Ligation of Genomic DNA to BD GenomeWalker Adaptor
GrM CLC Genome Finishing Module USER MANUAL User manual for CLC Genome Finishing Module 1 5 1 Windows Mac OS X and Linux August 20 2015 This software is for research purposes only CLC bio a QIAGEN Company Silkeborgvej 2 Prismet DK 8000 Aarhus C Denmark LC big A QIAGEN Company Contents 1 2 Introduction to the CLC Genome Finishing Module 1 1 Genome finishing lt ee ee 4 o 1 2 CLC Genome Finishing Module 2 68 co vee awe wee ee
Genome Biology ExpressionPlot x 7 ExpressionPlot a web based framework for analysis of RNA Seq and microarray gene expression data Friedman and Maniatis C BioMed Central Friedman and Maniatis Genome Biology 2011 12 R69 http genomebiology com 2011 12 7 R69 28 July 2011 Friedman and Maniatis Genome Biology 2011 12 R69 http genomebiology com 201 1 12 7 R69 Genome Biology SOFTWARE Open Access ExpressionPlot a web based framework for analysis
lt Genome Medicine Yeast Mapping Analysis Pipeline Ymar a pipeline for visualization of copy number variation and loss of heterozygosity in eukaryotic Abbey et al BioMed Central Abbey et al Genome Medicine 2014 6 100 http genomeme dicine com content 6 11 100 Abbey et al Genome Medicine 2014 6 100 http genomemedicine com content 6 1 1 100 X Genome Medicine SOFTWARE Open Access Ymar a pipeline for visualization of copy number variation and
Gen eCop 5 niai Expressway to Discovery Genome TALER amp Genome CRISPR Human AAVS1 Safe Harbor Gene Knock in Kit Catalog SH AVS K100 Catalog SH AVS K000 Catalog SH AVS K200 Catalog SH AVS K002 User Manual GeneCopoeia Inc 9620 Medical Center Drive 101 Rockville MD 20850 USA 301 762 0888 866 360 9531 inquiry genecopoeia com www genecopoeia com 2015 GeneCopoeia Inc USER MANUAL Genome TALER Human AAVS1 Safe Harbor Gene Knock
Metagenome Kin User Manual KIIN Metagenomee Kin Metagenome KIN User Manual ver2 01 Metagenome Kin User Manual Contact details World Fusion US Inc 4025 Camino Del Rio South Suite 300 San Diego CA 92108 TEL 619 542 7879 E mail techsupport w fusion co jp URL http www w fusion com All rights reserved under World Fusion US Inc No part of this documentation may be reproduced stored or transmitted in any form without the prior permission of World F
g e n om eS IM L A Reference Manual rev 1 0 1 We ep EES S by P BEE edes eRe EE Be Ep D ads EROL s CEE WEL genomeSIMLA A forward time simulation for genetic data http chgr mc vanderbilt edu genomeSIMLA Table of Contents Introduction 1 Purpose of this manual 1 Conventions Used 1 Random Numbers 1 Common Parameters 1 Integer 2 Float 2 Index 2 max 2 min 2 On Off 2 filename 2 label 2 description 2 Using genomeSIMLA 3 Comman
Gen eCop a ajg Expressway to Discovery Genome CRISP CRISPR Cas9 Products and Services User Manual GeneCopoeia Inc 9620 Medical Center Drive 101 Rockville MD 20850 USA 301 762 0888 866 360 9531 inquiry genecopoeia com www genecopoeia com 2015 GeneCopoeia Inc Genome CRISP CRISPR Cas9 Products and Services USER MANUAL Genome CRISP CRISPR Cas9 Products and Services Introduction Il Related Services Ill Overview of Genome Editin
Gen eCop e ajg Expressway to Discovery Genome TALER amp Genome CRISP Human AAVS1 Safe Harbor Gene Knock in Kits Catalog SH AVS K100 Catalog SH AVS K000 Catalog SH AVS K200 Catalog SH AVS K002 User Manual GeneCopoeia Inc 9620 Medical Center Drive 101 Rockville MD 20850 301 762 0888 866 360 9531 inquiry genecopoeia com www genecopoeia com 2014 GeneCopoeia Inc Human AAVS1 Safe Harbor Gene knock in Kits USER MANUAL Genome TALER