Cio GADGET A183 3W USB Dancing Water Speakers User Manual Please retain for future reference IMPORTANT Installer and Users please note These instructions should be read carefully and left with the user of the product for future reference Before use please inspect the product for any signs of damage If the product is damaged DO NOT use it and contact your supplier immediately OPERATING INSTRUCTIONS 1 Place the speakers on a clean level surface 2 One
AMrt UW Skwdard PRINCETON Installation Instructions PRESSURE BALANCING BATH AND SHOWER TRIM KITS T508 5OX Thank you for selecting American Standard the benchmark of fine quality for over 100 years To ensure that your installation proceeds smoothly please read these instructions carefully before you begin Certified to comply with ANSI A112 18 1 M968841 REV 1 4 RECOMMENDED TOOLS Plumbers Putty or Caulking Teflon Tape Phillips Screwdriver
Amti cmi SiaMclard COPELAIMD PRESSURE BALANCING BATH AND SHOWER TRIM KITS Installation Instructions T005 5XX Thank you for selecting American Standard the benchmark of fine quality for over 100 years To ensure that your installation proceeds smoothly please read these instructions carefully before you begin Certified to comply with ANSI A112 18 1 M968636 Rev 1 1 Recommended Tools Plumbers Putty or Caulking Teflon Tape Flat g ac e Screwdriver R
AhiMiam SfaMdard Installation Instructions TOWNSQUARE PRESSURE BALANCING BATH AND SHOWER with Built in Diverter for RIM MOUNT TUB FILLER with EverClean Finish Congratulations on purchasing your American Standard faucet with EverClean finish found only on American Standard faucets EverClean Finish One wipe effortlessly removes spots Eliminates the need for cleaners and scrubbing Permanent surface protectant remains beautiful for the life of the faucet
NTTAT Audio Conferencing System R Talk 800EX R T lk 800PC User s Manual First Edition December 1 2011 NTT Advanced Technology Corporation Table of Contents FOr YourSatety csc2s 2ciste lt secceeecs lek eta a rece os Secs Saeed eh he eee oescenes 3 Contents of This Package insoni n n cates cde eeeeetlv fn A daveb ATARE 8 Checking the Package of R Talk 800EX ccccccececeeeeeeeee seen ease eeeeeeaeaeeeenenees 8 Checking the Package of
BRAVIS Basic Videoconferencing System User Manual Table of Contents Introduction ee SER sel 4 SAI A Ran dain neil 5 SN A 5 Software requirements for 8 5 RIA A A vM A A eet pe A A d dE 5 Int rmi t aCcess isi ied DR IR ERREUR E RENE ER ERR ERER ER ER PR ER EREFERER ER R
Cisco Systems Installation and Upgrade Guide for Cisco Unified MeetingPlace Web Conferencing Release 6 x May 31 2007 Corporate Headquarters Cisco Systems Inc 170 West Tasman Drive San Jose CA 95134 1706 USA http www cisco com Tel 408 526 4000 800 553 NETS 6387 Fax 408 526 4100 Text Part Number OL 13418 01 THE SPECIFICATIONS AND INFORMATION REGARDING THE PRODUCTS IN THIS MANUAL ARE SUBJECT TO CHANGE WITHOUT NOTICE ALL STATEMENTS INFORMAT
111 111 CISCO Installation Guide for Cisco Unified Videoconferencing Manager Release 5 6 October 2008 Americas Headquarters Cisco Systems Inc 170 West Tasman Drive San Jose CA 95134 1706 USA http www cisco com Tel 408 526 4000 800 553 NETS 6387 Fax 408 527 0883 Text Part Number OL 16908 01 THE SPECIFICATIONS AND INFORMATION REGARDING THE PRODUCTS IN THIS MANUAL ARE SUBJECT TO CHANGE WITHOUT NOTICE ALL STATEMENTS INFORMATION AND RECO
ClearOne AUDIO CONFERENCING Conference Furniture SOLUTIONS GUIDE ai N WHO IS CLEARONE COMMUNICATIONS ClearOne is the leading provider of high performance audio conferencing solutions They introduced their first professional audio conferencing products to the market in 1990 under the brand name Gentner Since that time they have expanded and diversified their product line to meet all types of audio conferencing needs from personal conferencing o
BALANCING SOFTWARE FOR THE DC 12M VIBRATION ANALYZER Ver 3 79 USER S MANUAL Copyright 2000 2004 Inteltech Enterprises Inc Copyright 2000 2004 VAST Inc VAST BAL DC 12M User s Manual CONTENTS 1s BALANCING RE e 2 1 1 INTRODUCTION WEE 2 1 2 WHAT IS A MACHINE UNBALANCE 0 cece cece eee ee teen eea een enaes 3 1 3 BALANCING EE 3 1 4 SINGLE PLANE AND MULTIPLANE UNBALANCE teens 4 1 5 THE METHOD OF BALANCING WEIGHTS ANALYSIS eee 5 2 DC
Find Again DNA Sequencing Analysis Software Version 3 2 User s Manual Applied Biosystems DIVISION OF PERKIN ELMER Search Find Again Copyright 1998 The Perkin Elmer Corporation This product is for research purposes only ABI PRISM GeneScan Genotyper Perkin Elmer and Sequence Navigator are registered trademarks of The Perkin Elmer Corporation ABI the ABI PRISM design Applied Biosystems AutoAssembler BigDye BioLIMS Factura POP 6 PE PE Applie
Videoconferencing Camera Box In Wall Mounting Box for Videoconferencing Camera by Lr n Specifications Videoconferencing Camera Box _VideoConferencing Camera Boxes by Draper Inc Spiceland IN Camera box shall be a five sided formed steel enclosure with glass door front Five camera box enclosure panels shall be precision formed and punched from 18 gauge cold rolled steel with a black powdercoat finish Each camera box shall be provided with four 1 wire mana
1577 SequencPuzCrds TG 9 25 06 Page 1 anD ZZSDIcn Bump u apE I aouajajaj ajnjnj jo ssajppe jno u E aj asaaid n gt I ojjon uu 1 s Buix pn saajnosau 6uiujEai vs n ni sum uoujaA ou saajnosay 6uiujEa edoing y XTl 9Z2S9Z 991 0 PP epBUBQ S STl 606S ZZZ 008 l tui S STl 00178 SZ9 Z1 8 bo noA jbbu ja eep b jog PUZZLE CARDS Activity Guide Set of 10 double sided self checking puzzles Everyday Activitie
Ys ug eic TGACTGCATGACGTACGTACGACTGTC y ACGTACGACTGTGACTGACGTACGTAGCI User s Manual grece isa arie o TGACTGCATGACTGCATGACGTA ATGACGTACGTACGACTGT Maad ad aa GTACGTAGCTGACGATG TGCTGACGTACATGCA AGTCCTGACTGACT a Viel arr ACTGACGTACGTAG
RMX 2000 Getting Started Guide Version 1 1 POLYCOM Copyright 2007 Polycom Inc All Rights Reserved Catalog No DOC2159A Version 1 1 Proprietary and Confidential The information contained herein is the sole intellectual property of Polycom Inc No distribution reproduction or unauthorized use of these materials is permitted without the expressed written consent of Polycom Inc Information contained herein is subject to change without notice and does not r
A POLYCOM RMX 2000 Installation amp Configuration Guide General Safety Precautions Follow these rules to ensure general safety Keep the area around the Polycom RMX 2000 unit clean and free of clutter and well ventilated Decide on a suitable location for the equipment rack that will hold the RMX ensuring that it is near a grounded power outlet Ensure that the leveling jacks on the bottom of the rack are fully extended to the floor with the full weight of
Proto Balance SSL TLS Off Loading Load Balancing http www protonet co za User Manual SSL Copyright 2003 2010 Shine The Way 238 CC All rights reserved Proto Balance SSL User Manual March 13 2010 Contents 1 Introduction ii Ree ieee BS SN ares a ete a Magee eee ple ieee 25 SST OMS LOadin ge sert sence ee ee A A a nena A EE We Sele evel eo eee wae 3 Certificate Management ccc cece ccc ee ee eee eee ee ee ee ee ee eee eee e eee eee 4 C
QwikLink Tablet Charging and Syncing Device User s Manual Charge and Sync Charge Only Before Using Please read these operating instructions carefully They contain important advice concerning the use and Safety of your QwikLink Tablet Charging and Syncing Device The QwikLink must only be used for its intended purpose in accordance with these operating instructions Any misuse of the product will void the warranty READ ALL INSTRUCTIONS prior to using the Q
Operating Manual U S ien 4 fu Snia son M4 cuir for PAPU Soniye dt ups HS A RR dat ue an E Ak Dh LI 10k m HI Frequency Hz Level Ch2 1V 1m m Time js D 500g n 15m gm 0 wai Sei E a Bou UPP 800 AUDIO ANALYZER OMORE rim IN 7 DIGITAL AUDIO KOM ANALOG IH a ANALOG OUT 77 ESET CASCADE LAN H 1175 6390 02 02
RH U B TurboMeeting User Manual Version 6 0 RHUB Communications Inc 4340 Stevens Creek Blvd Suite 282 San Jose CA 95129 support rhubcom com http www rhubcom com Contents PrelaC tem 4 Jganiza loas S E OES 4 TONINO V ae a a a E E 4 CONSTANTS orones iera e a aa a aa raaa 5 TurboMeeting Control Panel and Key Functions for Presenter sseeeuusss 5 Ws Set ng UD TurboMeellng cio eet o toe a Ih eee one ier ve eres teu 6 1 1
GIBCOBRL Instruction Manual Model S2 Sequencing Gel Electrophoresis Apparatus CAT SERIES 21105 Lire TECHYOLOGIES Essential Technologies for the Science of Life Table of Contents 1 Notices to CUSTOMER ccc cc ec eseeeeeeeeeeeeeeeeeeeeneeteneeeenseneeeees 1 1 1 Important Information eee eeeeeeeeeeeeenneeeeeeeeteeeeeeaeeeseaeeeseneeseeneeeeee 1 L2 Warnings aap SH le le adapted Sede asd ieee ede deed 1 2 Overview jcc boo oo eee A e
UNI EN ISO 9001 2008 CERT N 9105 BNVD C UNI EN ISO 14001 2004 8 slo O C ERT N 9191 BNVN hi e VENDING GROUP USE AND MAINTENANCE MANUAL Translations of the Original Instructions sar bianchihoreca com BVM 346 Maggiori informazioni si possono scaricare dal nuovo portale di Bianchi Vending Group all indirizzo M290 repshop bianchivendina P Per accedervi per necessario essere in possesso di
SELF BALLANCING ELECTRIC SCOOTER User s Manual Operating your intelligent electric scooter safely 1 1 Using the Scooter Safely a Our company would like to ensure that all drivers can operate their intelligent electric self balancing scooter safely and enjoy the fun that it will bring Always remember that learning to ride this scooter is like learning to ride a bicycle driving a car or other forms of transportation that you ve used Those previous experiences can
Sequencing Gel Casters Models SGC 1 and SGC 2 Operating and Maintenance Manual 7218313 Visit us online to register your warranty w www thermoscientific com warranty Owl Ki A eparation Preface MANUAL NUMBER 7218313 0 4 25 12 Transfer to Marietta was 3 2003 CCS REV ECR ECN DATE DESCRIPTION By Thermo Scientific Sequencing Gel Caster i Preface CAUTION Contains Parts and Assemblies Susceptible to Damage by Electrostatic Discharge ESD
TANDBERG 380 User Manual Software version B4 D12788 01 This document is not to be reproduced in whole or in part without permission in writing from TANDBERG TANDBERG Videoconferencing System TANDBERG Videoconferencing System Introduction This User Manual is provided to help you make the best use of your TANDBERG system The TANDBERG system offers superior quality audio and video in a fully featured unit
TANDBERG Gateway User Manual Software version G3 D13187 03 This document is not to be reproduced in whole or in part without permission in writing from TANDBERG TANDBERG Gateway TANDBERG Gateway Trademarks and copyright COPYRIGHT 2005 TANDBERG Philip Pedersensvei 22 1366 Lysaker Norway Tel 47 67 125 125 Fax 47 67 125 234 All rights reserved This document contains information that is proprietary to TANDBERG No part of this publication may be r
TANDBERG See amp Share Conferencing Software User guide D13166 05 March 2009 Contents Contents Overview 4 Introducing See amp Share Conferencing Software 4 What would you like to do 4 System Requirements 4 System requirements 4 Software Requirements 4 Getting See amp Share Conferencing Software 5 The See amp Share Software Interface 5 Starting and Exiting See amp Share Software 6 Joining a Conference 8 Joining a conference from an email invitatio
TANDBERG 7000 User Manual Software version E2 D13099 02 This document is not to be reproduced in whole or in part without permission in writing from TANDBERG TANDBERG Videoconferencing System Acaution LCD MONITORS Panel sticking and after image lag Avoid displaying the same images continuously over a long period of time on the TANDBERG 7000 monitors Displaying the same images such as still images for a long time may cause after image lagging This may oc
Sentencing Support Tools user manual for judges Michael Marcus revised July 28 2009 Introduction Sentencing Support Tools provide a resource that so far is available to judges nowhere else in the world By identifying the offender and the charge for which you are considering a sentence you can access within seconds a display of recidivism data for similar offenders sentenced for similar crimes in correlation with any of the sentencing elements previously given to such offend
Celeritec Tally Version 4 User Manual Celeritec Tally User Manual Bringing Balance to Your Business by Celeritec Retail Systems This guide has been written to help new users of Celeritec Tally Version 4 to set up the program in as short a time as possible The guide will help you tailor the program to your exact business needs A real world example is used throughout the manual to demonstrate how you can set up the software If you have any comment
TANDBERG 000MXP User Manual Software version F2 D13354 03 This document is not to be reproduced in whole or in part without permission in writing from 01335403 T7000 MXP User Manual CAUTION Avoid displaying the same images continuously over a long period of time on the monitors Displaying the same images such as still images for a long time may cause after image lagging This may occur in the following two cases 1 After image lagging due to re
H uma Ser sre Se ICC CENTRE FOR DEVELOPMENT OF ADVANCED COMPUTING GNU Linux For Cognitively Challenged 0 1 2 User Manual _ a Pu i E This GNU Linux distribution is aimed to provide an accessible desktop environment to the cognitively challenged people For more details about the distribution please refer to Read Me This document describes the various features of the distribution and their usage in detail Salient features Desktop is
EXECUTIVE S Conferencing USER MANUAL For Executive Conferencing Table of Contents How to Start a Conference Call nnannnnnannvnnnnvnnnnvrvnnnrnnnnnnnnnrrennnrnnnnnnnnenrnnnnrnennnrnnsnnresssrresnnnnnennnnnn 2 System Features si icun er eee aa ta vlecesyess 2 EE ENE EEE suber deestedeceedudeasaasdsenanesucsasesniedaie 6 Online Customer Care Center mnrnurnrvnannrnnannvnnnrrnnnnrnnannvennnvnnnnrrnannrnnannnnennrennnrnnsennennenresnnrnnennnennnee 6 Appendix
User Manual for MEGAN V3 8 Daniel H Huson and Stephan C Schuster with contributions from Alexander F Auch Daniel C Richter Suparna Mitra and Qi Ji February 4 2010 Contents Contents 1 1 Introduction 3 2 Getting Started 5 3 Obtaining and Installing the Program 5 4 Program Overview 6 5 Importing Reading and Writing Files 6 6 The NCBI Taxonomy 7 7 The NCBI NR and NCBI NT Databases 7 8 Identification of COGs 7 9 Assigning Reads to Taxa 8 10 Assigning Reads to Gene On
User Manual For Sequencing Service Management Add on for LabCollector La bC ollector By AgileBio www AgileBio com www LabCollector com AGILEBIO Team Solutions support agilebio com The information in this document shall not be disclosed outside your organization and shall not be duplicated used or disclosed in whole or in part for any purpose other than to evaluate the proposal provided that if a contract is awarded to AGILEBIO as a result of or in connection w
Valves World Wide 30 03 2010 Vexve Balancing Valve User Manual Vexve Balancing Valve User Manual Table of Contents 10 General Precautions and Notifications Markings Valve Transportation and Storage Installations and Welding to the Pipeline 5 1 Welding Commissioning and Use 6 1 Calculating the Pre Set Values 6 2 Setting the Pre Set Values 6 3 Flow Measuring Maintenance 7 1 Assembly Disassembly of Manual Gear 7 1 1 Adjusting of Manual Ge