ABI PRISM 377 DNA Sequencer For Sequencing and GeneScan Analysis Software Applications User s Manual Applied E Biosystems Copyright 2000 Applied Biosystems For Research Use Only Not for use in diagnostic procedures NOTICE TO PURCHASER This instrument Serial No is Authorized for use in DNA sequencing and fragment analysis This authorization is included in the purchase price of this instrument and corresponds to the up front fee component of a licen
AS 16 Analog Sequencer Rack Extension for Propellerhead Reason User Manual Version 1 0 INTRODUCTION AS 16 is a fully featured CV based analog sequencer It implements the following features e 16CV channels with separate CV outputs e Skip Jump and Pad features for each channel e Unipolar Bipolar and Note output modes e Common musical scales with selectable root note via Ul or MIDI e Octave and range controls when in Note mode e Normal One Shot and Random
AS 16 Analog Sequencer Rack Extension for Propellerhead Reason User Manual Version 1 1 INTRODUCTION AS 16 is a fully featured CV based analog sequencer It implements the following features e 16CV channels with separate CV outputs e Skip Jump and Pad features for each channel e Unipolar Bipolar and Note output modes e Common musical scales with selectable root note via Ul or MIDI e Octave and range controls when in Note mode e Normal One Shot and Random
x AL ofer lt DUAL ENGINE PHRASE REPEATER AUDIO SAMPLE LIBRARY FOR NI KONTAKT 5 5 a DRAMASCORE SERIES Audiofier SEQui2R User Manual August 2015 The information in this manual is subject to change without notice The software described by this document may not be copied to other media All trademarks are the property of their respective owners and use of them does not imply any affiliation with or endorsement by them Table of Contents Welcome to SEQui2R Audi
Cufflinks Transcript assembly differential expression ANN BS x and differential regulation for RNA Seq ENEA Please Note If you have questions about how to use Cufflinks or would like more information about the software please email tophat cufflinks gmail com though we ask you to have a look at the paper and the supplemental methods first as your question be answered there Site Map Home Getting started Manual How Cufflinks works Index and annotation downloads
DaySequerra ILC 2ST User Manual Welcome Thanks for purchasing the DaySequerra ILC2ST Differences in audio levels between TV programs or between programs and commercials are a constant annoyance to viewers ILC2STST permits broadcasters to establish a consistent loudness level across all audio programming and minimize viewer complaints We design and build all of our DaySequerra products to be completely reliable and easy to use so you can concentrate on producing gr
aySequerra Radio Tuner I Radio Tuner 2 Radio Tuner 3 FM 89 3MHz ST FM 89 3MHz HD I FM 89 3MHz HD 2 AUTO WTLS AUTO WTLS AUTO WTLS so omav ser TUNER ALARM DaySequerra soon M3 H Radio Multi Tuner M3 User Manual Welcome Thanks for purchasing the DaySequerra M3 HD Radio Multi Tuner We design and build all of our DaySequerra products to be completely reliable and easy to use so you can concentrate on producing great sounding broadcasts not
DIGILINE SYSTEMS The Complete Electronic Solution DIGILINE SYSTEMS ar ISO 9001 2008 CERTIFIED MFG OF POWER SUPPLIES SMPS BATTERY CHARGERS AC CONTROLLERS B1 18 DSIDC FLATTED FACTORY COMPLEX A BLOCK JHILMIL INDUSTRIAL AREA DELHI 95 www digilinesystems com Table of Contents 1 Introduction 1 0 Features 1 1 Parameters Setting 1 2 Factory Default Settings 1 3 Parameters Range 2 Specifications Table 3 Work Principle of Sequence Controller
2002 Dimension One Spas Export Owner s Manual 2002 Dimension 0 ne Spas Export Owner s Manual Table of Contents IMPORTANT SAFETY INSTRUCTIONS 1 HYPERTHERMIA 2 DO S AND DONTS 3 WARNING SIGNS 4 HOT TUB FEATURES 5 ADDITIONAL FEATURES FORTHE CHAIRMAN CHAIRMAN II DIPLOMAT CALIFORNIAN NAUTILUS AURORA XLT AURORA II CALIENTE HP AND TRIAD II 5 ADDITIONAL FEATURES FORTHE ARENA AURORA HP CALIENTE AND TRIAD 5 Jet System Selector Valve 5 N eckFlex Jet Pillow 6 Ult
Find Again DNA Sequencing Analysis Software Version 3 2 User s Manual Applied Biosystems DIVISION OF PERKIN ELMER Search Find Again Copyright 1998 The Perkin Elmer Corporation This product is for research purposes only ABI PRISM GeneScan Genotyper Perkin Elmer and Sequence Navigator are registered trademarks of The Perkin Elmer Corporation ABI the ABI PRISM design Applied Biosystems AutoAssembler BigDye BioLIMS Factura POP 6 PE PE Applie
Seguence Classifier for Geneious R8 or later Aaron Kennedy USDA APHIS PPO and Biomatters November 10 2014 geneioug Overview The Classify Seguences plugin classifies a guery seguence by aligning it against all seguences in a specified database and then choosing an appropriate taxon according to user specified identity levels Single or multiple genes can be used for classification and multiple query sequences can be run at once The plugin first performs pairwise g
div container main div wrap Timing rendered on www14 us archive org seconds diff sec message stack file line function 0 0000 0 0000 petabox start var cache petabox petabox www sf download php 1 require common ia 66 require_once
div container main div wrap Timing rendered on www16 us archive org seconds diff sec message stack file line function 0 0000 0 0000 petabox start var cache petabox petabox www sf download php 1 require common ia 66 require_once
div container main div wrap Timing rendered on www07 us archive org seconds diff sec message stack file line function 0 0000 0 0000 petabox start var cache petabox petabox www sf download php 1 require common ia 66 require_once
JunctionSeq Package User Manual Stephen Hartley National Human Genome Research Institute National Institutes of Health December 10 2015 JunctionSeq v0 6 26 Contents 1 Overview 2 Requirements AAA AE OEE eA See 2 2 Recommendations 0 0 02 a a et ee 3 Example Dataset 4 Preparations 4 1 Generating raw counts via QoRTS 4 2 Merging Counts from Technical Replicates If Needed 4 3 Option 1 Including Only Annotated Splice J
1577 SequencPuzCrds TG 9 25 06 Page 1 anD ZZSDIcn Bump u apE I aouajajaj ajnjnj jo ssajppe jno u E aj asaaid n gt I ojjon uu 1 s Buix pn saajnosau 6uiujEai vs n ni sum uoujaA ou saajnosay 6uiujEa edoing y XTl 9Z2S9Z 991 0 PP epBUBQ S STl 606S ZZZ 008 l tui S STl 00178 SZ9 Z1 8 bo noA jbbu ja eep b jog PUZZLE CARDS Activity Guide Set of 10 double sided self checking puzzles Everyday Activitie
LISST ABS Acoustic Backscatter Sensor User s Manual Version 1 0 July 2015 SEQUOIA Sequoia Scientific Inc 2700 Richards Road Suite 107 Bellevue WA 98005 USA Phone 1 425 641 0944 Fax 1 425 643 0595 support SequoiaSci com www SequoiaSci com This page intentionally left blank FOR TECHNICAL ASSISTANCE please contact your local Distributor or Sequoia if the instrument was purchased directly from Sequoia Please be sure to include the instrume
Marley Multicell Motor Sequencer User Manual 00 1177 Cooling Technologies Balcke Hamon Dry Cooling Marley Warning Installation Introduction The Marley 6 and 12 stage Multicell Motor Sequencers are designed to control multiple cell cooling towers in such a way that required cooling will be done with maximum efficiency and minimum wear to cooling tower mechanical equipment Temperature is monitored at a common return line and fans are turned on as neede
UsersManual The Sequelll Speaker System Hall a TLQGANLID Important Your Sequel Il speakers are provided with an automatic Limited 90 Day Warranty coverage You have the option atno additionalcharge to receive Limited 3 Year Wa manty coverage To obtain Limited 3 Year Wa manty coverage you need only complete and retum the Certificate of Registration that was included with your speakers to Martin Logan within 30 days of purchase Martin Logan may not honor wa
MSSIAH MIDI SID SOFTWARE Sequencer MIDI SID SOFTWARE Introducir ia 6 Using the MSSIAH Sequencer scccscccssccsssssscsccsscccssscssccssesescscscsssssccssccesscessnesssccsseseoes 7 A A TA 7 The Basics union ta pa eden BO Ras aa eee eae tees 7 UR Ee S 8 User Input Controls cc ccccccssccisessescesesescasscnsescesacsssctsvesoscecensses seecsscosstonssocsepestecesepsssosesedsess toasstes 9 J OVSUCK ees aot ces lesen shee tas edes eee oa a 9 TA 9 Amiga MOUSE t
University of Illinois at Urbana Champaign Luthey Schulten Group NIH Resource for Macromolecular Modeling and Bioinformatics Multiseq User s Manual 10M maliseg OX Y VID Main o Be Est Sah Tub s er Fie Maece Graphics Ds Nowe Exensons Heh D i m iW TAD F Miele Aes Funes Ud PIA D H 3 ADF liado SECO gt AKY DP SURGES VS 2 ADF Kia RECS GKNOSPVN 5 5 K ERIKSON ADF NCP OKDROSP IW DIK k ARIFF F G ADF 1JD0pds Pe ou T NL a vs cm T7 Je _ ADE Cp
Cat No I215E EN 01 Pump Sequencer Application Software Model 3G3MX2 CX Drive Version 2 7 0 14 USER S MANUAL SSS Boe NV N d gt ee NYU hg co yA LLL 0 Notice OMRON products are manufactured for use according to proper procedures by a qualified operator and only for the purposes described in this manual The following conventions are used to indicate and classify precautions in this manual Always heed the information provided with th
Ys ug eic TGACTGCATGACGTACGTACGACTGTC y ACGTACGACTGTGACTGACGTACGTAGCI User s Manual grece isa arie o TGACTGCATGACTGCATGACGTA ATGACGTACGTACGACTGT Maad ad aa GTACGTAGCTGACGATG TGCTGACGTACATGCA AGTCCTGACTGACT a Viel arr ACTGACGTACGTAG
Read This Manual First Before Using This Product This Manual Contains Important Product and Safety Information o b n i e n WATER SKI amp BINDING OWNERS MANUAL Congratulations on your purchase of one of the finest watersports products available O Brien uses the very best materials to help insure a long lasting quality product Please complete and remove the warranty card included with your new ski and mail it within 10 days of purchase Before using your new product
interalia DIGITAL VOICE ANNOUNCER PAGING SEQUENCER OPERATING MANUAL TABLE OF CONTENTS INTRODUCTION ll 1 INSTALLATION lean 2 Rear Panel DeSCription iaiaeiaeiaa aate adia 2 Unpacking the Announcer 4 Installation Procedure 4 OPERATION csl ili hide psi arida 5 Recording Announcements voice prompts disabled 5 Recording Announcements voice prompts enabled 5 Announcement Playback 7 MAINTENANC
Peak Finder Meta Server PFMS User Manual Computational amp Systems Biology ICM Uppsala University http www icm uu se 1 1 Overview PFMS is a free software application which identifies genome wide transcrip tion factor binding sites from CHIP Seq data PFMS combines identified sites from seven different peak finders after making a scoring based compar ison it gives the highest ranked overlapped peaks 1 2 Download PFMS PFMS is a free software implemented in
Operating Manual U S ien 4 fu Snia son M4 cuir for PAPU Soniye dt ups HS A RR dat ue an E Ak Dh LI 10k m HI Frequency Hz Level Ch2 1V 1m m Time js D 500g n 15m gm 0 wai Sei E a Bou UPP 800 AUDIO ANALYZER OMORE rim IN 7 DIGITAL AUDIO KOM ANALOG IH a ANALOG OUT 77 ESET CASCADE LAN H 1175 6390 02 02
RNA seq analysis with CANEapp User Manual Dmitry Velmeshev Patrick Lally Faghihi s lab University of Miami Contents WY AG USC sororia EE PFEFEQUISILOS ei aan a A e NES INSTA ALI ON esnea a MO SUING sirens a sovicsueysin det seusatwactwoeitalscersaiweusversiateewtusatweseved Analysis Quick guide cccccccsscsosccccccccecscsccccccccscscncsccscecccccncns Creating a new project Adding experimental groups Adding samples step one Adding sample
GIBCOBRL Instruction Manual Model S2 Sequencing Gel Electrophoresis Apparatus CAT SERIES 21105 Lire TECHYOLOGIES Essential Technologies for the Science of Life Table of Contents 1 Notices to CUSTOMER ccc cc ec eseeeeeeeeeeeeeeeeeeeeneeteneeeenseneeeees 1 1 1 Important Information eee eeeeeeeeeeeeenneeeeeeeeteeeeeeaeeeseaeeeseneeseeneeeeee 1 L2 Warnings aap SH le le adapted Sede asd ieee ede deed 1 2 Overview jcc boo oo eee A e
Aluminum Backed Sequencer Models S4S and S3S Operating and Maintenance Manual 7007348 Rev 0 Visit us online to register your warranty www thermoscientific com warranty amp Owl Preface MANUAL NUMBER 7007348 0 4 26 12 Transfer to Marietta was T rex 01 2004 ccs REV ECR ECN DATE DESCRIPTION By Thermo Scientific Aluminum Sequencer i Preface CAUTION Contains Parts and Assemblies Susceptible to Damage by Electrostatic Discharge ESD Imp
SURGEX energy intelligence SEQ SEQ 1U SURGEX Programmable Sequencer Surge Eliminator Power Conditioner User Manual Software Version 2 0 SurgeX Technical Support 800 645 9721 surgex com SURGEX SEQ SEQ 1U User Manual energy intelligence Software Version 2 0 U S Patent Nos RE39 446 6 728 089 6 744 613 6 947 266 7 068 487 7 184 252 7 511 934 7 541 696 and 7 551 412 U S Patent Application Publication Nos 20090303648 20110063759 2
User Manual eQuinox eQuinox A CAIRE A Chart Industries Company AirSep SeQual eQuinox User Controls System Status Indicators Definition Definition FAA Approved Symbol The U S Federal Aviation Administration FAA has approved this device for use on board commercial aircraft Read user manual before operation See user manual for instructions No Smoking Icon Do not smoke near unit Flow Setting Indicator Warnings ALERT Yellow Ind
eSEQUuAL INTEGRA Oxygen Concentrator INTEGRA E Z INSTRUCTION MANUAL Model 6323A OM 10 Model 6323A 10 P N 7040 Rev B March 2011 SEQUAL TABLE OF CONTENTS Warnings and GE VIUIO ERE EE ER 3 l e es tos TOR EEE EE EE REE m 4 Cont NI 4 IDEO SUICIDE EEE EE EE EE E DEN MM ML LEAD MM 4 TegioT9 Bez auis Eee UCO RE EE EEE EE NE SE EN RE re 4 Symbols Used in Instruction Manual and on Oxygen Concentrator sisnnssrsesssrrrrrsrrrrrrrrrresrrererrrrrrrrrrrrr
gesneiton GS Development Services ES Sequel USER MANUAL SDS Sequel User Manual Table of Contents Contents Getting Stated ee 2 Technical Contents ee 11 Global Properties Contents 2222 20 Project Explorer Contents 22 of Reports Contents 102 page U DS Sequel User Manual Getting Started Logging In When you start Sequel you will see the Login screen This will prompt you for your username password the database server and the database itself
BioQUEST A DA WSs t n ie Library VII Allen R Place Thomas Schmidt Sequence It Version 1 38 User s Manual University of Maryland Biotechnology Institute University of Maryland Biotechnology Institute A BioQUEST Library VII Online module published by the BiOQUEST Curriculum Consortium The BioQUEST Curriculum Consortium 1986 actively supports educators interested in the reform of undergraduate biology and engages in the collaborative development of curricula
DMX512 A Rotator Standard Version Instruction Manual Hardware Revision 0 August 31 2014 Durand Interstellar Inc Rpt 7 219 Oak Wood Way Z Los Gatos CA 95032 2523 SC 408 35b 388b Table of Contents Table eg eat i ESS CUD OM EEN 1 SR le Mel EE 2 Mounting amp GCONMECUING EE 3 SEENEN 4 LV FS e EE 5 PMXSIZA CONTO bureie E aca aaaiabieaedommniseanelneaeaahe raed 6 e 8 California Proposition 65 VWammmg E EN 9 ep OF 5 1 95 0 ee 9 Alen le
Manua E SEQUENTIAL CM3000C Publications Department March 1988 PROPHET 3000 16 BIT STEREO SAMPLING SYSTEM OPERATION MANUAL by Stanley Jungleib 3051 North First Street San Jose California 95134 2093 U S A Phone 408 433 5240 Fax 408 433 5230 Telex 4997 150 SEQCIR PAN SEQUENTIAL Radio Frequency Interference RFD Notice This equipment generates and can radiate radio frequency energy and if not installed and used
President s Letter Guarantee Certificate Two Warranty Registration Certificates Certificate of Measured Performance Operational Instructions Installation Instructions Front Illustration Immediate Operation Description of Tuner Displays Back Panel Illustration Description of Back Jack 2 Detailed Description of Scope Graticule and Trace Descriptions Simplified Theory of Operation Block Diagram Back Jack Panel Socket
ACUSON SEQUOIA 512 ULTRASOUND SYSTEMS ACUSON SEQUOIA C512 ECHOCARDIOGRAPHY SYSTEMS ACUSON SEQUOIA C256 ECHOCARDIOGRAPHY SYSTEMS User Manual Siemens Medical Solutions USA Inc 1230 Shorebird Way Mountain View CA 94043 1344 U S A 800 498 7948 650 969 9112 C CE Declaration 0123 This product is provided with a CE marking in accordance with the regulations stated in Council Directive 93 42 EEC of June 14 1993 concerning Medical Devices Sie
Sequoia User Manual Michael Bauer John Clark Eric Schkufza Alex Aiken May 24 2010 Contents 1 2 Introduction Sequoia Installation 2 1 2 2 2 3 2 4 2 5 Downloading Sequoia 40 ton a ans de ran m da Directory Structures arta ra ir o Ave ten eee lk DA Compiler Dependencies 2 CH nn nn 2 3 1 7 Ele amp Old sa 82 eed BEE SA RR rh et Namen 2 3 2 XerCes iara Bh sei Sa da Bayt thd hae ate Had Pata ie nd Building the Compiler s vec dosi p
Sequencing Gel Casters Models SGC 1 and SGC 2 Operating and Maintenance Manual 7218313 Visit us online to register your warranty w www thermoscientific com warranty Owl Ki A eparation Preface MANUAL NUMBER 7218313 0 4 25 12 Transfer to Marietta was 3 2003 CCS REV ECR ECN DATE DESCRIPTION By Thermo Scientific Sequencing Gel Caster i Preface CAUTION Contains Parts and Assemblies Susceptible to Damage by Electrostatic Discharge ESD
0 SINGER Futura Quartet Feature Benefit 4 in 1 Sewing Embroidery Quilting and Serging No need for multiple machines in your sewing room One machine four functions sewing embroidery quilting and serging SwiftSmart Threading System Simply guide the thread directly from the spool to the needle area through a single groove and thread the needle by pressing the threading lever for easy needle threading Independent Bobbin Winder Continue to sew whil
0 SINGER Futura Quartet SEQS 6000 Feature Benefit 30 Built In Sewing Stitches 6 Basic 17 Decorative 5 Stretch and 2 Buttonholes 2 Fully Automatic 1 Step Buttonholes A simple 1 step process that provides reliable precisely balanced buttonholes every time Buttonhole Underplate The buttonhole underplate ensures perfect buttonholes on multiple fabric lay ers It makes sewing buttonholes possible in places that conventional button hole devices cannot ea
TOYOTA moving forward 2009 Quick Reference Guide 2009 Sequoia This Quick Reference Guide is a summary of basic vehicle operations It contains brief descriptions of fundamental operations so you can locate and use the vehicle s main equipment quickly and easily The Quick Reference Guide is not intended as a substitute for the Owner s Manual located in your vehicle s glove box We strongly encourage you to review the Owner s Manual and supplementary manuals
User Manual for MEGAN V3 8 Daniel H Huson and Stephan C Schuster with contributions from Alexander F Auch Daniel C Richter Suparna Mitra and Qi Ji February 4 2010 Contents Contents 1 1 Introduction 3 2 Getting Started 5 3 Obtaining and Installing the Program 5 4 Program Overview 6 5 Importing Reading and Writing Files 6 6 The NCBI Taxonomy 7 7 The NCBI NR and NCBI NT Databases 7 8 Identification of COGs 7 9 Assigning Reads to Taxa 8 10 Assigning Reads to Gene On
User Manual For Sequencing Service Management Add on for LabCollector La bC ollector By AgileBio www AgileBio com www LabCollector com AGILEBIO Team Solutions support agilebio com The information in this document shall not be disclosed outside your organization and shall not be duplicated used or disclosed in whole or in part for any purpose other than to evaluate the proposal provided that if a contract is awarded to AGILEBIO as a result of or in connection w
HORNER APG User Manual for the HE693SER300 Sequence of Events Recorder Module Second Edition November 25 2003 0078 02 PREFACE 25 NOV 2003 PAGE 3 PREFACE This manual explains how to use the Sequence of Events Recorder Module Copyright C 2003 Horner APG LLC 640 North Sherman Drive Indianapolis Indiana 46201 All rights reserved No part of this publication may be reproduced transmitted transcribed stored in a retrieval system or tran
User Manual for Wormfinder Daniel A Wagenaar This user manual describes the Wormfinder Matlab user interface and is meant to be read in conjunction with the paper that describes the algorithm Wormfinder uses D A Wagenaar and W B Kristan 2009 Automated Video Analysis of Animal Movements submitted to Neuroin formatics Loading images or video sequences Click the Load image s button to open the file selection dialog box which can be used to naviga
NSG 3040 EMC TEST SYSTEM USER MANUAL More Application Information and Pricing available at 250 Technology Way sales testworld com Rocklin CA 95765 1 855 200 TEST 8378 Click to go www TestWorld com TASEO 601 279F Advanced Test Solutions for EMC NSG 3040 EMC TEST SYSTEM USER MANUAL CONTENTS 2 1 3 1 3 2 33 3 4 3 5 3 6 4 1 4 2 4 3 4 4 4 5 4 6 4 7 5 1 5 2 53 5 4 6 1 6 1 1 6 1 2 6 1 3 Explanation of symbo